BEHR ULTRA™ Interior Matte

Average Rating:
false

To bring classic beauty to all of your home's interior walls, choose BEHR ULTRA Interior Matte. This traditional matte paint will create a low-reflective appearance that's perfect for all of your home's rooms. It's also great for hiding minor flaws, dents and nicks.

Finish
A matte sheen has a flat, low-reflective finish that's easy to clean, touches up well and will also hide minor surface imperfections.
Best for use in
Ideal for all rooms
Coverage
250-400 Sq. Ft. per Gallon

Read important application instructions to ensure optimum paint performance.

Pink and purple colored brush strokes

Find Your Perfect Color!

Find, Coordinate & Preview Paint Colors

Explore our color library. Browse our collections of popular and trending colors.  Find coordinating colors then preview them in your own virtual room image. Do it all with ColorSmart by BEHR®.

Explore Color Now

Sold Exclusively at
The Home Depot

Find a Home Depot store near you.

Light blue and light green brush strokes

Product Usage

Clock icon

1 HR Dry Time 
2 HR Recoat Time

Paint coverage icon.

250-400 Sq. Ft 
Coverage per Gallon

Soap and water cleaning a paint brush icon

Soap & Water
Clean-Up

Thermometer Icon

Protect
from Freezing

Where to Use

Properly prepared coated and uncoated Interior surfaces. Ideal for Family Rooms, Living Rooms, Dining Rooms, Bedrooms, Hallways and Ceilings.

Usage Summary
Preparation & Prime†
  • All surfaces should be properly prepared and cleaned. Remove loose paint, wash off dirt and grease with detergent, rinse and allow to dry.
  • Remove mildew stains with a mildew stain remover. Scuff sand glossy surfaces and repair imperfections. Remove all dust with a damp cloth, allow to dry.
  • Allow new stucco, plaster and masonry to cure for 30 days before painting.
  • Use BEHR ULTRA paint as a primer for properly prepared uncoated or painted interior surfaces, including woods that contain tannins (two primer coats required for redwood and cedar) and heavily stained areas.
  • Lock in stains with BEHR ULTRA as a spot primer.
  • For heavy stains, test for stain bleed-through by applying BEHR ULTRA as a topcoat to a small section. If the stain bleeds through the topcoat, spot prime another coat to the stained area and test again before topcoating. If bleeding continues, a longer dry time is needed before top coating.
  • For drastic color changes or when applying deep colors denoted with a dagger (†) on the color chip, apply a tinted primer coat of BEHR ULTRA if needed.
Application
  • Apply when air and surface temperatures are between 50-90°F (10-32°C).
  • Stir paint occasionally. Intermix containers of same product to ensure color and sheen uniformity.
  • Use a high quality 3/8-1/2" nap roller cover, nylon/polyester brush or an airless sprayer (.015-.019" spray tip, 60 mesh filter).
  • Do not thin if using a roller or brush; however, if using a sprayer and thinning is required, thin with water at a rate of no more than 1/2 pint per gallon.
  • Certain colors may require more than one coat for complete hide.
  • Darker colors may require additional dry time between coats. Cooler temperatures or higher humidity may prolong drying time.
  • After 4 weeks, cured paint film may be cleaned with a mild, non-abrasive liquid detergent. Dry paint film is mildew resistant.
  • Do not use on floors.
Disposal
  • For disposal of empty containers, unused paint and soiled rags, contact your household refuse collection service.

Read Application Instructions

LIFETIME LIMITED WARRANTY

Behr Process Corporation warrants to you, the original residential consumer purchaser, the performance of this product as described on this label for so long as you reside in your home. THIS WARRANTY IS NOT VALID WHEN THE PRODUCT IS NOT PROPERLY APPLIED TO A PROPERLY PREPARED SURFACE OR CARED FOR IN ACCORDANCE WITH THE LABEL DIRECTIONS. This warranty is not transferable. If this product is found not to perform as specified on the label during the warranty period, Behr Process Corporation will, at its option and upon presentation of proof-of-purchase (the original receipt), either furnish an equivalent amount of new product or refund the original purchase price of this product to you. This warranty excludes (1) labor and costs of labor for the application or removal of any product, and (2) any incidental or consequential damages, whether based on breach of express or implied warranty, negligence, strict liability or any other legal theory. Some states do not allow the exclusion or limitation of incidental or consequential damages, so the above limitation or exclusion may not apply to you. This warranty gives you specific legal rights and you may also have other rights, which vary from state to state. Note to residents of the State of New Jersey:  The provisions of this warranty, including its limitations, are intended to apply to the fullest extent permitted by the laws of the State of New Jersey. To obtain warranty service, call 1-800-854-0133. Behr Process Corporation reserves the right to inspect any and all application of the product prior to processing your claim made under this warranty.

Read Warranty Information

BEHR ULTRA™ Interior Matte is rated 4.7 out of 5 by 35.
Rated 5 out of 5 by from sdfasdf companies and websites Protect your privacy! Don't include any personally identifiable information Refrain from including information about special offers or pricing All reviews are subject to the: Customer Ratings and R
Date published: 2013-08-14
Rated 5 out of 5 by from Awesome Good Hide and Better for cleaning stuff. My kid makes them so dirty. But now I don't have to worry.
Date published: 2013-08-07
Rated 5 out of 5 by from Test Review Title Nam gravida justo ut metus ultricies eleifend. Nullam nec dui sit amet sapien molestie pretium sed vitae justo. Quisque dignissim eu ligula quis dignissim. Suspendisse blandit ornare lorem, vel venenatis dolor ultricies quis. Nam ac ullamcorper nisi, non pulvinar nunc. Aenean adipiscing metus tristique quam elementum varius ut vitae arcu. Praesent ac commodo nisi, a convallis nisl. Donec fringilla tristique ligula a consequat. Integer lacinia lorem ac pulvinar ornare. Morbi eget mi molestie; sed.
Date published: 2013-07-01
Rated 4 out of 5 by from Nullam eu nisi a velit consecteturegestas. Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpisegestas.Class aptent taciti sociosqu ad litora torquent per conubia nostra, per inceptoshimenaeos.Mauris vel justo nec mi laoreet porta quis utlacus.Fusce sed diam arcu, vel sodaleslacus.Duis ac enim non dui gravida lacinia sed vitaejusto.
Date published: 2013-05-20
Rated 5 out of 5 by from Tester testtesttest This is a test re we view.This is a test re we viewThis is a test re we viewThis is a test re we view
Date published: 2019-02-27
Rated 5 out of 5 by from TestReviewer 007 Testing disclaimers. This is a test. Testing disclaimers. This is a test.
Date published: 2016-03-17
Rated 5 out of 5 by from abc catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcat
Date published: 2015-03-03
Rated 5 out of 5 by from best Test review the best of the best. Just love it....
Date published: 2015-02-10
Rated 5 out of 5 by from TEST DELETE TEST DELETE TEST DELETE TEST DELETE TE TEST DELETE TEST DELETE TEST DELETE TEST DELETE TETEST DELETE TEST DELETE TEST DELETE TEST DELETE TETEST DELETE TEST DELETE TEST DELETE TEST DELETE TE
Date published: 2014-05-27
Rated 5 out of 5 by from Morbi semper facilisistincidunt. In tellus diam, mollis ac suscipit non, malesuada sedmetus.Nullam malesuada purus nec tortor convallis vitae consectetur sapiensodales.Nunc lorem neque, condimentum id fermentum a, aliquam sit ametligula.Sed ullamcorper dignissim est idporttitor.
Date published: 2014-05-21
Rated 4 out of 5 by from Nunc congue semper lectus euporttitor. Aenean fringilla ultricesultrices.Nunc sollicitudin, odio eu interdum lobortis, dui risus mattis eros, sit amet laoreet urna sem necnisi. Aenean vulputate mi non quam egestasconvallis.Mauris nisi erat, mollis quis rutrum et, viverra utmi.Suspendisse rhoncus, libero non vehicula sodales, nisl lorem vestibulum magna, non condimentum nisl est quisligula. Nullafacilisi.In tellus diam, mollis ac suscipit non, malesuada sedmetus.Nullam malesuada purus nec tortor convallis vitae consectetur sapiensodales.Nunc lorem neque, condimentum id fermentum a, aliquam sit ametligula.
Date published: 2014-05-08
Rated 4 out of 5 by from In hac habitasse plateadictumst.Ut a elitmi. Curabitur feugiat libero at velit aliquetlacinia.Sed rutrum quam sit amet purus luctus at aliquet antedapibus.In leo libero, aliquam et pretium vitae, hendrerit atdui.Fusce condimentum posuerevenenatis. Sed vel nisl a mi pellentesque porta ut arisus. Phasellus euismod porttitor enim, vitae rhoncus risus pellentesquea.
Date published: 2014-05-08
Rated 5 out of 5 by from TEST TestingTesting Testing Testing Testing testings tisng
Date published: 2014-05-02
Rated 5 out of 5 by from Love Behr!! This paint was so easy to apply and turned out looking wonderful! Clean up was a breeze.
Date published: 2014-05-02
Rated 5 out of 5 by from test test test test test test test test test test test test
Date published: 2014-04-04
Rated 4 out of 5 by from test for design testing for design review, testing for design review
Date published: 2013-11-07
Rated 5 out of 5 by from need to see thank you box color This is QA Test-need an example of thank you box color
Date published: 2013-09-27
Rated 4 out of 5 by from sdvsdvsdvscvcc dcfsdcsdcscsdcdewfcdsvsdvcvcxvxcvfdvdadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadadav
Date published: 2013-09-04
Rated 5 out of 5 by from QA ReViEw afdasfdaf a afdadfa afdsaf. aldfja;dkdfa alkfdjl;akj f. alfdkjf
Date published: 2013-08-06
Rated 5 out of 5 by from Sandy's test Your Review text area. this is a test conducted by Sandy westphal
Date published: 2013-08-02
Rated 4 out of 5 by from Test Review Title Ut nec lobortis enim. Integer consectetur, turpis quis scelerisque luctus, nisl eros blandit mi, eu porta neque quam non quam? Duis non sagittis sem. Curabitur a ante eu lorem laoreet scelerisque ut nec mi. Maecenas luctus, ipsum quis gravida sollicitudin, metus est ultricies ligula, ac consequat dolor odio at nibh. Aliquam hendrerit ultricies vehicula. Sed ac enim rhoncus, pharetra purus ac, mollis urna. Curabitur nisl leo, lobortis eu elementum vitae, consectetur eu nisi. Morbi in turpis duis.
Date published: 2013-08-01
Rated 5 out of 5 by from Best Purchase Ever Best Purchase EverBest Purchase EverBest Purchase EverBest Purchase EverBest Purchase EverBest Purchase Ever
Date published: 2013-07-23
Rated 5 out of 5 by from test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test
Date published: 2013-07-19
Rated 4 out of 5 by from Suspendisse ornare tellus quis mi laoreetrutrum. Mauris ut lacus non arcu faucibus scelerisque volutpat rhoncusdiam.Maecenas non sodalesdui.Vestibulum porta lacus at eros auctor vitae tincidunt ligulaporttitor.Cras gravida accumsan eros, imperdiet mollis magna commodosed. Donec vehicula velitdolor.Maecenas malesuada malesuada dolor etcongue.
Date published: 2013-04-28
Rated 4 out of 5 by from Cras consequat orciante.Etiam ac volutpatmi. Suspendisse ornare tellus quis mi laoreetrutrum.Vivamus enim arcu, aliquet eget interdum eget, porttitor amassa.Proin blandit eleifendviverra.Praesent rutrum urna at turpis suscipit eu malesuada semscelerisque.Praesent sodales neque non mauris porttitorsuscipit.
Date published: 2013-04-28
Rated 5 out of 5 by from Fusce sed diam arcu, vel sodaleslacus. Aliquam vitae risus a felis lobortismolestie.Aenean nec scelerisquenunc.
Date published: 2013-02-08
Rated 4 out of 5 by from Aliquam lacinia auctoraccumsan. Vestibulum arcu magna, pellentesque non pellentesque sit amet, varius nonmetus.Phasellus sit amet quam lectus, ac sagittiserat.Quisque nec velit sit amet arcu mattislaoreet.Curabitur facilisis venenatis est asollicitudin. Donec tempor, est ut placerat congue, ipsum sem iaculis ante, quis commodo mi turpis velturpis.Curabitur sit amet orcilorem.Praesent eleifend porta turpis dapibusultricies.Maecenas tincidunt lorem vitae magna auctorcondimentum. Donec interdum erat eu arcu vehiculagravida.Quisque cursus pulvinar ligula, sed accumsan felis interdumid.Nullam erat augue, condimentum et fermentum vitae, dapibus sedurna. Etiam sapien dolor, consequat nec tincidunt et, interdum euquam.Curabitur pulvinar nulla ut mauris varius in aliquam ligulasemper.Sed pellentesque quam hendrerit enim vulputate in lacinia dolorultrices.Quisque turpis odio, bibendum non iaculis eu, consequat inelit.Maecenas massa ante, ullamcorper at posuere sed, vestibulum egetneque.Ut porttitor erat sit amet enim elementumdictum.Sed ultricies ultricies erat, quis blandit augue convallisnec.Donec molestie eleifend elit, vitae congue orci gravidavel. Aenean rutrum egestas lectus placeratlobortis.Aenean fringilla ultricesultrices.Ut dictum imperdiet augue, eu pretium quam aliquamnon.Suspendisse et risus sit amet arcu mattis eleifend sit amet sollicitudinnunc.
Date published: 2013-01-30
Rated 4 out of 5 by from Sed ullamcorper dignissim est idporttitor. Fusce condimentum posuerevenenatis.Sed vel nisl a mi pellentesque porta ut arisus.Phasellus euismod porttitor enim, vitae rhoncus risus pellentesquea.Vestibulum quis vulputateodio. Nam in sapien sit amet justo convallis ultrices at vitaesem.Nunc metus diam, aliquet id scelerisque sed, laoreet infelis. Morbi dictum porta tellus, vitae bibendum diam iaculisid.Nulla eget nuncleo.Mauris lobortis tempus sem sit ametdictum.Suspendisse quam eros, porttitor eu rhoncus at, euismod elementumlorem. Nam pharetra elit vel ipsum pretium ut aliquam ligulafaucibus.Maecenas vel massa urna, vehicula malesuadadui.
Date published: 2013-01-09
Rated 5 out of 5 by from Nunc congue semper lectus euporttitor. Ut lobortis ullamcorper sapien quismalesuada.Curabitur rhoncus convallis metus, vitae hendrerit diam interdum sitamet.Sed mollis lorem pulvinar diam dictum nec aliquet purusconsequat.Nam lorem lacus, pellentesque cursus faucibus vitae, tristique etelit. Proin turpis dui, euismod in luctus eget, vehicula neclectus.Lorem ipsum dolor sit amet, consectetur adipiscingelit.Nullam volutpat nulla in quam laoreet ut porttitor semmolestie. Aliquam cursus, massa ac faucibus elementum, ligula lectus rutrum tortor, sed blandit leo elit aceros.Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpisegestas.Class aptent taciti sociosqu ad litora torquent per conubia nostra, per inceptoshimenaeos.Mauris vel justo nec mi laoreet porta quis utlacus. Fusce sed diam arcu, vel sodaleslacus. Duis ac enim non dui gravida lacinia sed vitaejusto.Donec facilisis quam eget libero accumsanfaucibus.Suspendisse adipiscing, odio eu dictum consectetur, diam nibh interdum leo, id laoreet risus nisl velorci.Praesent sollicitudin massa quis risus rutrum eu placerat purusrhoncus.
Date published: 2012-12-03
Rated 5 out of 5 by from Aenean rutrum egestas lectus placeratlobortis. Aliquam eratvolutpat.Curabitur iaculis blandit nulla, sed gravida ante molestieut.Integer aliquet dignissim mauris acpellentesque.Sed nisi erat, malesuada eget tincidunt in, vulputate quissapien.
Date published: 2012-11-30
  • y_2020, m_2, d_27, h_14
  • bvseo_bulk, prod_bvrr, vn_bulk_3.0.5
  • cp_2, bvpage2n
  • co_hasreviews, tv_0, tr_35
  • loc_en_US, sid_1010101000042-I, stg, sort_[SortEntry(order=FEATURED, direction=DESCENDING), SortEntry(order=SUBMISSION_TIME, direction=DESCENDING)]
  • clientName_behr
  • bvseo_sdk, java_sdk, bvseo-4.0.0
  • CLOUD, getContent, 282ms
  • REVIEWS, PRODUCT

How-To

Find step-by step instructions in our how-to articles and videos.