Tahitian sky
What sheen do I need?
8 Oz. Sample
1 Gallon
1 Quart
5 Gallon
The following product(s) is required to properly prep and pre-treat wood prior to any stain project.
Required product
The following product(s) is required to properly prep and pre-treat wood prior to any stain project. Only available in store at Home Depot.
Required 3rd party product
The 9 in. x 1/4 in. Polyester Adhesive Roller Cover has a hard texture, making it ideal for applying all types of adhesives to smooth surfaces. It can be used for stippling and applying sand paints.
The following product(s) is recommended when stripping is needed.
The Home Depot logoSold Exclusively at The Home Depot

BEHR® Oil-Base Satin Enamel

Avg. Rating:

For a tough, easy-to-clean look on multiple vertical surfaces, use BEHR Oil-Base Satin Enamel. This mildew-resistant formula is fast drying, and will help protect both interior and exterior surfaces from scuffs, rust and household chemicals.


Satin Finish.

Best for use in

Ideal for Wood, Drywall, Plaster, Masonry, Metal, Well-bonded Wallpaper, Brick, Stucco, Aluminum and Cinder Block.


350-550 Sq. Ft per Gallon

Clock icon

4-5 HR Dry Time
24 HR Recoat Time

Paint coverage icon.

350-550 Sq. Ft.
Coverage per Gallon

Mineral Spirits Icon

Mineral Spirits

Thermometer Icon

from Freezing

Properly prepared Interior or Exterior surfaces such as: Wood, Drywall, Plaster, Masonry, Metal, Well-bonded Wallpaper, Brick, Stucco, Aluminum and Cinder Block. Do not use on horizontal surfaces.

Read More

Proper surface preparation is required

  • Allow new stucco, plaster and masonry to cure for 30 days.


  • For interior and exterior surfaces, remove dirt, oil and grease stains with a concrete & masonry degreaser and cleaner product.
  • Remove mildew stains with a mildew stain removing product.
  • Remove all loose and peeling paint; scuff sand glossy surfaces; caulk; repair imperfections and sand smooth.
  • For exterior surfaces, power wash to remove chalk.
  • Etch galvanized metal with a concrete & masonry cleaner & etcher product.


  • Use a product such as BEHR PREMIUM PLUS® No. 436 Exterior Multi-Surface Primer & Sealer. Follow all label instructions.
Read More

  • DO NOT THIN. Stir before and during application.
  • When working with more than one can of the same product, intermix to ensure color uniformity.
  • Use adequate ventilation during application & drying process.
  • Certain colors may require more than one coat to achieve complete hide and coverage.
  • Use product when air and surface temperature are 40-90˚F (4-32˚C).
  • Apply a thin coat using a high quality china bristle brush, 1/4”-3/8” nap roller or an airless sprayer (.013”-.015” spray tip).

Read More

  • Longer dry time required in cooler temperatures and higher humidity.
  • Wait at least 7 days before rinsing or cleaning the surface with a mild, non-abrasive detergent.
Read More

  • Properly dispose of all soiled rags.
  • For disposal of empty containers and unused product contact your household refuse collection service.
Read More


BEHR ® Oil-Base Satin Enamel is rated 4.7 out of 5 by 3.
Rated 4 out of 5 by from Praesent eleifend porta turpis dapibusultricies. Caum sociis natoque penatibus et magnis dis parturient montes, nascetur ridiculusmus.Nunc iaculis porta dolor, et aliquam urna hendreritvel.Duis ut nibh ut mi tincidunt ornare nec necneque.Etiam ac volutpatmi.
Date published: 2018-04-05
Rated 5 out of 5 by from Fusce sed diam arcu, vel sodaleslacus. Mauris ullamcorper metus vitae dolor dignissimporttitor.Sed vestibulum varius leo, vitae mollis elit eleifenda. Sed tempus lectus eget risus variuscursus.Aenean eleifend mauris sed tortor venenatis quis sagittis erateuismod.Praesent quis ante erat, sit amet conguenulla.Sed posuere pharetra massa aaliquam.
Date published: 2016-01-04
Rated 5 out of 5 by from catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatca catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcat
Date published: 2015-03-04
  • y_2021, m_6, d_22, h_13
  • bvseo_bulk, prod_bvrr, vn_bulk_3.0.17
  • cp_1, bvpage1
  • co_hasreviews, tv_0, tr_3
  • loc_en_US, sid_1015008000080-E, stg, sort_[SortEntry(order=FEATURED, direction=DESCENDING), SortEntry(order=SUBMISSION_TIME, direction=DESCENDING)]
  • clientName_behr
  • bvseo_sdk, java_sdk, bvseo-4.0.0
  • CLOUD, getContent, 243ms
Often Bought Together
BEHR<sup>®</sup> Multi-Surface Stain-Blocking Primer & Sealer
BEHR® Multi-Surface Stain-Blocking Primer & Sealer
Learn More

Find step-by-step instructions in our how-to articles and videos.



For one year from the date of purchase, Behr Process Corporation warrants to the original consumer purchaser, (1) that the product meets Behr Process Corporation’s manufacturing specifications, and (2) the performance of this product when applied according to the label instructions and specifications. If this product is found not to perform as specified on the label within one year from the date of purchase, Behr Process Corporation will, at its option and upon presentation of proof-of-purchase (the original receipt), either furnish an equivalent amount of new product or refund the original purchase price of this product to you. This warranty excludes (1) labor and costs of labor for the application or removal of any product, and (2) any incidental or consequential damages, whether based on breach of express or implied warranty, negligence, strict liability or any other legal theory. Some states do not allow the exclusion or limitation of incidental or consequential damages, so the above limitation or exclusion may not apply to you. To the extent permitted by applicable law, any implied warranties including the implied warranties of merchantability and of fitness for a particular purpose, are limited to the duration of this express warranty.  Some states do not allow limitations on how long an implied warranty lasts, so the above limitation may not apply to you. This warranty gives you specific legal rights and you may also have other rights, which vary from state to state. Note to residents of the State of New Jersey: The provisions of this warranty, including its limitations, are intended to apply to the fullest extent permitted by the laws of the State of New Jersey. To obtain warranty service, call 1-800-854-0133. Behr Process Corporation reserves the right to inspect any and all application of the product prior to processing your claim made under this warranty.

Never miss out on the hottest deals and latest news from BEHR.

Please enter email address.
Please enter email address.